O To Be Like.

Image coding the Bard into DNA makes for intriguing data storage prospects. This portrait, possibly by John Taylor, is one of the few images we have of the playwright (now on display at the National Portrait Gallery in London).
Goldman and Birney are talking about DNA as an alternative to spinning hard disks and newer methods of solid-state storage. Their work is given punch by the calculation that a gram of DNA could hold as much information as more than a million CDs. Here’s how The Guardian describes their method. The scientists developed a code that used the four molecular letters or “bases” of genetic material – known as G, T, C and A – to store information. Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT.

To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC understand this well it comes down to the blips and bits. As not to over complicate this they hope to simplify the binary code to include a more citified computer code. For example when installing a system over another system the first whole system is compressed if the sequences is unraveled and compressed it will free up a lot more data. As humanity is in the early days of computing more integrated systems will become a future possibility.  The converted sonnets, along with DNA coding of Martin Luther King’s ‘I Have a Dream’ speech and the famous double helix paper by Francis Crick and James Watson, were sent to Agilent.

A US firm that makes physical strands of DNA for researchers. The test tube Goldman and Birney got back held just a speck of DNA, but running it through a gene sequencing  machine, the researchers were able to read the files again. And mille sections instantly appear.
This parallels work by George Church (Harvard University), who last year preserved his own book Regenesis via DNA storage. As you can see that the line centered at a frequency of .01 corresponds to the function’s period of 100 time units. Well if you’re up to speed. I would have typed this yesterday, more later makes for as Book Club say 'Is this your book then yea or'.